Coral Ridge Ministries and CSI

[Nineveh]

Originally posted by Agent Smith

As far as the article from Nature, for whatever reason, I can't get it to load any longer. Maybe you geniuses can figure that out.

This it?
http://www.nature.com/nsu/040524/040524-8.html

Chimp chromosome creates puzzles
First sequence is unexpectedly different from human equivalent.
27 May 2004
LAURA NELSON


Thousands of chimp genes could significantly differ from those in humans.
© Alamy.com



What is the difference between a chimp and a human? There could be a lot more to the answer than scientists thought, according to the first accurate DNA sequence of a chimp chromosome.

We already knew that around 98.5% of the base pairs that make up our DNA are the same as those in chimps. So the old idea was that all the things that differentiate us from apes, such as highly developed cognitive functions, walking upright and the use of complex language, should come from the other 1.5%.

Scientists had hoped this would mean the key genetic changes that enabled such traits to evolve would be easy to find. But the latest evidence suggests that the journey from ape to human was much more complex.

Todd Taylor at the Riken Genomic Sciences Center in Yokohama, Japan, and his colleagues have read the DNA sequence of chimpanzee chromosome 22, and compared it to its human counterpart, chromosome 21. Although a draft sequence of the chimp genome has been available since August 2003, this is the first sequence of a whole chimp chromosome that is accurate enough for researchers to be sure that any differences between the two species are real, and not just data errors.

Not so human

The sequences of chimp chromosome 22 and human chromosome 21 are roughly equivalent. Out of the bits that line up, 1.44% of the individual base pairs were different, settling a debate based on previous, less accurate studies.

However, the researchers were in for a surprise. Because chimps and humans appear broadly similar, some have assumed that most of the differences would occur in the large regions of DNA that do not appear to have any obvious function. But that was not the case. The researchers report in Nature1 that many of the differences were within genes, the regions of DNA that code for proteins. 83% of the 231 genes compared had differences that affected the amino acid sequence of the protein they encoded. And 20% showed "significant structural changes".

In addition, there were nearly 68,000 regions that were either extra or missing between the two sequences, accounting for around 5% of the chromosome. "We already knew that at the DNA level we are similar to chimpanzees," says Taylor. "But we have seen a much higher percentage of change than people speculated."

The researchers also carried out some experiments to look at when and how strongly the genes are switched on. 20% of the genes showed significant differences in their pattern of activity.

Chromosome 22 makes up only 1% of the genome, so in total there could be thousands of genes that significantly differ between humans and chimps, says Jean Weissenbach from France's National Sequencing Centre in Evry. This could make it much harder than scientists had hoped to find the key changes that made us human.

Nonetheless, Taylor and his team plan to use their chimp sequence to home in on important differences between the two species. "We have to work out which proteins have a functional impact," says Taylor. The researchers have already identified two genes called NCAM2 and GRIK1, the human versions of which contain large sections that are missing in the chimp. Both genes are known to be involved in neural function.

Genome feast

The sequence of chromosome 22 has also whetted researchers' appetites for the full chimp genome sequence, due to be published in Nature later this year. "The small section of the genome is very valuable," says Ajit Varki, a molecular biologist at the University of California, San Diego. "But the whole genome will be a wonderful tool."

Weissenbach is looking even further ahead. He points out that the best way to narrow down which of the differences between the two genomes are really key to making us human is to compare the sequences with those of other great apes. "Do we now need the gorilla genome sequence?" he says.

 

[Free-Agent Smith]

Originally posted by Nineveh

This it?
http://www.nature.com/nsu/040524/040524-8.html

Thank you Nineveh.

 

[Jukia]

I guess I am missing something, what is this Nature article supposed to show, other than the differences between a particular human & chimp chromosome are larger than expected?

 

[john2001]

Originally posted by Nineveh

I agree, they aren't all fools and liars, I would describe them as dogmatic. When you start with the base assumption to prove that very same assumption there isn't much room left for science.

It's amazing so many are "unschooled" when the very basics have been taught in public school for how long? What's the latest estimate for fed grants to "get the message out" and research? It seems the museums at least might be able to help the "unschooled" but all we get is theory sans evidence.

The established wisdom of yesterday is being challenged by the complexity we see at the cellular level today. Evo is going to have to change it's MO from BOLD CLAIM + No Evidence = science, or suffer losing more ground than it has gained since chuck wrote his book.

Dogmatic? Get real. Biologists are dogmatic about evolution in the same way that physcists are dogmatic about gravity. The phenomenon is taken for granted, but the details and theories proposed to understand those details are where the controversy lies.

There are absolutely no scientic challenges to the basic notion of evolution, which is to say the notion of "common descent through descent with modification". Indeed, this basic fact should be obvious to anybody who has even an introductory brush with the notion of taxonomy.

The more you learn regarding biology, the more complicated it gets, to be sure, but the more powerful the notion of common descent becomes in navigating that complexity.

Finally, today, a week cannot go by where we do not see a story about the genome of some species being mapped. Each of these is the supreme test of the notion of evolution.

Somehow we don't see the notion of common decent being challenged by this.

Indeed, any so called claim of "evidences contradicting evolution" usually consists of a laundry list created out of misunderstood, misrepresented, or just plain wrong arguments that may be scientific sounding, but in truth have little substance.

 

[Free-Agent Smith]

Originally posted by Jukia

I guess I am missing something, what is this Nature article supposed to show, other than the differences between a particular human & chimp chromosome are larger than expected?

No matter how much someone wants to say that we evolved from apes, it is becoming harder and harder to back it up with evidence from the DNA samples.

 

[Nineveh]

Originally posted by john2001

Dogmatic? Get real. Biologists are dogmatic about evolution in the same way that physcists are dogmatic about gravity. The phenomenon is taken for granted, but the details and theories proposed to understand those details are where the controversy lies.

Gravity can be proven in a lab. Abiogenesis hasn't been. Biology scrapped Haeckel's "spontaneous regeneration", it's evo that needs to pick through biology's trash for a "law". So, personally, I think the definition of dogma fits nicely here.

There are absolutely no scientic challenges to the basic notion of evolution, which is to say the notion of "common descent through descent with modification". Indeed, this basic fact should be obvious to anybody who has even an introductory brush with the notion of taxonomy.

Taxonomy is sorting with our criteria. It simply shows commonality not descent. A tool like Taxonmomy is useful when it isn't abused.

The more you learn regarding biology, the more complicated it gets, to be sure, but the more powerful the notion of common descent becomes in navigating that complexity.

From your point of view. But from mine the more we look at the functions of the cell, the more complex the smallest building blocks of life get. Darwin had no idea how complex a cell is, but today we have no excuses.

Finally, today, a week cannot go by where we do not see a story about the genome of some species being mapped. Each of these is the supreme test of the notion of evolution.

And much like Agent Smith pointed out, the further from common descent we get.

Somehow we don't see the notion of common decent being challenged by this.

And that is why I said "dogmatic".

Indeed, any so called claim of "evidences contradicting evolution" usually consists of a laundry list created out of misunderstood, misrepresented, or just plain wrong arguments that may be scientific sounding, but in truth have little substance.

Like I said, after all these years and millions of dollars later "misunderstood, misrepresented, or just plain wrong" can be placed at the feet of the evos who can't define their own words.

And I would also add, evos aren't helping the situation when they decide to strike off with their own "layman" definitions in an effort to sound "more knowledgeable".

So I'll stick with the "mainstream" evo-science when it comes to "understanding" evo.

 

[Nineveh]

Originally posted by Jukia

I guess I am missing something, what is this Nature article supposed to show, other than the differences between a particular human & chimp chromosome are larger than expected?

..have read the DNA sequence of chimpanzee chromosome 22, and compared it to its human counterpart, chromosome 21.

***

Because chimps and humans appear broadly similar, some have assumed that most of the differences would occur in the large regions of DNA that do not appear to have any obvious function. But that was not the case. The researchers report in Nature1 that many of the differences were within genes, the regions of DNA that code for proteins. 83% of the 231 genes compared had differences that affected the amino acid sequence of the protein they encoded. And 20% showed "significant structural changes".

In addition, there were nearly 68,000 regions that were either extra or missing between the two sequences, accounting for around 5% of the chromosome.

The researchers also carried out some experiments to look at when and how strongly the genes are switched on. 20% of the genes showed significant differences in their pattern of activity.

Chromosome 22 makes up only 1% of the genome, so in total there could be thousands of genes that significantly differ between humans and chimps,...

That's only after one chromosome comparison. I tend to think there will be more differences than similarities with each chromosome we compare. Darwin's tiny changes over time are getting harder and harder, not easier and easier.

 

[aharvey]

Originally posted by Nineveh

I agree, they [meaning scientists, and I'l guess evolutionary biologists specifically] aren't all fools and liars, I would describe them as dogmatic. When you start with the base assumption to prove that very same assumption there isn't much room left for science.

This is a hilarious quote. I love the barely unspoken inference that most are fools and liars. Right in line with Agent Smith's "scientists use words carelessly." It may be true that you can find careless word use, foolishness, and lies in the scientific community, but I predict that on a per capita (that means per person) basis, you'll find less of each of these among evolutionary biologists than in the population as a whole, and among creationists in particular.

Originally posted by Nineveh

I would describe them as dogmatic. When you start with the base assumption to prove that very same assumption there isn't much room left for science.

This part bears requoting. Out of context, I'll bet virtually everyone would assume you were referring to creationists. For crying out loud, dogma is a theological term! Are you implying that you are not as dogmatic about your beliefs as scientists are about the things they study? Are you implying that it would even be remotely possible for evidence to change your mind about, say, the origin of biological diversity or the age of the Earth? In contrast, most scientists, myself included, are certainly not wedded to a 4.5 billion year old earth; that's just what the evidence we have now strongly suggests. If better evidence suggests otherwise, then we'll go with the better evidence. It's happened before! Ironically, creationists complain about this, too!

And I'm curious. What base assumption do you think we use to "prove" itself? The basic assumption I work with is that natural processes (e.g., gravity) have always worked the same way they do now (though not necessarily at the same rate). Is this what you mean?

 

[Nineveh]

Originally posted by aharvey

This is a hilarious quote. I love the barely unspoken inference that most are fools and liars. Right in line with Agent Smith's "scientists use words carelessly." It may be true that you can find careless word use, foolishness, and lies in the scientific community, but I predict that on a per capita (that means per person) basis, you'll find less of each of these among evolutionary biologists than in the population as a whole, and among creationists in particular.

Well, you know I won't agree with your assessment, but I will make a prediction, the closer we look at the cell the less "evo" biologists there will be, at least the ones who are honest with themselves. Biology will be returned to science and the part of evo that works (adaptation) will be returned to it's rightful place as a tool within biology.

This part bears requoting. Out of context, I'll bet virtually everyone would assume you were referring to creationists. For crying out loud, dogma is a theological term! Are you implying that you are not as dogmatic about your beliefs as scientists are about the things they study? Are you implying that it would even be remotely possible for evidence to change your mind about, say, the origin of biological diversity or the age of the Earth? In contrast, most scientists, myself included, are certainly not wedded to a 4.5 billion year old earth; that's just what the evidence we have now strongly suggests. If better evidence suggests otherwise, then we'll go with the better evidence. It's happened before! Ironically, creationists complain about this, too!

Creationists are free to look at the evidence (like you can't have a proteins without instructions, and you can't have instructions without proteins) without chuck and the mainstream looking over their shoulders. The evidence doesn't need to be explained it needs to be described without the fairy tale work evo needs to add on.

Here, since you were kind enough to give me the definition of "per capita" let me help you out with "dogma":
1 a : something held as an established opinion; especially : a definite authoritative tenet b : a code of such tenets c : a point of view or tenet put forth as authoritative without adequate grounds

"Abiogenesis" is quite nicely explained with dogma, because the lab isn't helping. If evo had some proof of it's claims besides pretty story telling, I might be inclined to change my position.

And I'm curious. What base assumption do you think we use to "prove" itself? The basic assumption I work with is that natural processes (e.g., gravity) have always worked the same way they do now (though not necessarily at the same rate). Is this what you mean?

Well, Mr. Smith asked what the laws were that governed evo, he got how many answers? So, please, don't ask me to define your science for you. But, let me ask you, which missing link binds adaptation to one kind changing into another?

On a personal note, from what I have seen, I'll say what chuck says governs your "science" no matter what lengths evo may need to go to in it's story telling, chuck is always right.

 

[john2001]

Originally posted by Nineveh

john2001 said...
Biologists are dogmatic about evolution in the same way that physicists are dogmatic about gravity.

Gravity can be proven in a lab. Abiogenesis hasn't been. Biology scrapped Haeckel's "spontaneous regeneration", it's evo that needs to pick through biology's trash for a "law". So, personally, I think the definition of dogma fits nicely here.

Basically, the general pattern of observations of biology, all the way from traditional taxonomy down to the genetic level point to a general pattern of "relatedness" of all of biology. Hence, the notion of evolution, is indeed a phenomenon that is observed.

As to the laws of biology, these would be:
1) taxonomy
2) faunal succession (including the notion that lines may become extinct)
3) variation of allele frequencies with time.

Common descent via descent with modification explains neatly the vast collection of biological observation. This is the phenomenon of evolution.

These laws neatly sum up the majority of biological observation. Indeed, any alternate view of biology must necessarily be something that will account for the "evolution" appearance of all of biology.

As to your comments regarding abiogenesis, it is irrelevent to the theory of origin of species if we ever understand the ultimate origin of life. Abiogenesis is a completely separate topic from evolution.

john2001 wrote:
The notion of evolution should be apparent to anyone with a familiarity with taxonomy

Taxonomy is sorting with our criteria. It simply shows commonality not descent. A tool like Taxonmomy is useful when it isn't abused.

Yes. FYI *all* scientific laws are our[ criteria. They are reductions of what are observed. The power of such critera is that they organize large collections of observations in a form that leads to theoretical understanding. In the case of the modern application of taxonomy via comparative genetics, we see a refinement of taxonomy, not its replacement or abandonment.

john 2001 wrote to the effect

...evolution is necessary for navigating the complexity of biology [revealed by modern observations]...

From your point of view. But from mine the more we look at the functions of the cell, the more complex the smallest building blocks of life get. Darwin had no idea how complex a cell is, but today we have no excuses.

It's not my point of view alone, it is the point of view shared by mainstream biologists (which is to say the people who are actual practicing scientists in the field, as opposed to so-called creationist scientists, who do nothing but rant.)

Indeed, the brilliance of Darwin was to propose a system that lead to so much of modern biology. However, "Darwinian" evolution today really is not the same theory as that proposed by Darwin, because he did not know about genetics.

And much like Agent Smith pointed out, the further from common descent we get.

And that is why I said "dogmatic".

On the contrary. Everybody is now splitting hairs about what percentage of relatedness humans are to chimpanzees. The fact of that relatedness is not under dispute by mainstream scientists.

Like I said, after all these years and millions of dollars later "misunderstood, misrepresented, or just plain wrong" can be placed at the feet of the evos who can't define their own words.

And I would also add, evos aren't helping the situation when they decide to strike off with their own "layman" definitions in an effort to sound "more knowledgeable".

So I'll stick with the "mainstream" evo-science when it comes to "understanding" evo.

What is quite clear is that you, as well as Agent Smith, and every other creationist on this forum, have preciious little knowledge of mainstream science, or you would recognize the attempts of myself, aharvey, and others to educate you on what are common concepts in the scientific community.

Indeed, the rejection of evolution tends to be proportional to an individuals ignorance of the subject.

 

[aharvey]

Originally posted by Nineveh

Well, you know I won't agree with your assessment, but I will make a prediction, the closer we look at the cell the less "evo" biologists there will be, at least the ones who are honest with themselves. Biology will be returned to science and the part of evo that works (adaptation) will be returned to it's rightful place as a tool within biology.

I made a prediction, not an assessment (creationists do commonly confuse the two!); the assessment of the prediction has not yet been done. It would be feasible to collect some relevant data, though, if you’re game!

Originally posted by Nineveh

Creationists are free to look at the evidence (like you can't have a proteins without instructions, and you can't have instructions without proteins) without chuck and the mainstream looking over their shoulders. The evidence doesn't need to be explained it needs to be described without the fairy tale work evo needs to add on.

Well, that's a basic difference between you and most scientists. We look at description as a starting point, not an end point. Scientific theories exist to provide explanations, not descriptions. True for cell theory, theory of gravity, etc., as much as it is for evolutionary theory.

And your examples of “evidence” leave a lot to be desired. Your statement “you can't have a proteins without instructions, and you can't have instructions without proteins” is an assertion, not evidence. You need evidence to back up these assertions; is there any? To what instructions do you refer, and how does a creationist or scientist quantify them? If such instructions (however defined) do exist, and proteins do exist, then I’d say your assertion is already incorrect!

Originally posted by Nineveh

Here, since you were kind enough to give me the definition of "per capita" let me help you out with "dogma":
1 a : something held as an established opinion; especially : a definite authoritative tenet b : a code of such tenets c : a point of view or tenet put forth as authoritative without adequate grounds

Subtle but critical difference between b and c, don’t you think? Who decides whether the grounds for religious dogma are “adequate”? Who decides whether the grounds for scientific dogma are “adequate”?

Originally posted by Nineveh

"Abiogenesis" is quite nicely explained with dogma, because the lab isn't helping. If evo had some proof of it's claims besides pretty story telling, I might be inclined to change my position.

It’s a curious thing. Creationists are about the only people I have ever heard use the term “abiogenesis,” and are about the only people who ‘think’ about it; very few evolutionary biologists worry much about “abiogenesis.” Why? Because at some point, it is trivially true, and completely independent of evolutionary theory. Unless life has always been present throughout all of time, then life had to have been derived from non-living precursors. There are only two differences between our perspectives; the first is that you think it is more reasonable that the complexities of the genetic code were resolved completely, instantly, and independently for each kind of living organism, whereas I think it is more reasonable that it took a long time to reach the current complexity of the genetic code, and that this process is still continuing, and that living organisms share the history of this process. The second difference is that you think that if evolutionary theory can’t “prove how” life evolved from non-life, then evolutionary theory can’t explain anything, and I think that evolutionary theory doesn’t need to prove anything (no theory can, as I’ve explained many, many times here), doesn’t even have to explain everything to be useful, and specifically doesn’t need to conclusively demonstrate what happened at the very beginning to be able to account for what’s happened since.

Originally posted by Nineveh

Well, Mr. Smith asked what the laws were that governed evo, he got how many answers? So, please, don't ask me to define your science for you.?

Believe me, I would never rely on you to define my science. I just thought that when you referred to a “base assumption used to prove itself,” you were referring to something in particular. The base assumption I use did not fit your description, so I asked for clarification. Perhaps even you don’t know to what you were referring?

Originally posted by Nineveh

But, let me ask you, which missing link binds adaptation to one kind changing into another

Read that sentence out loud. It makes no sense. Whatsoever. At the least, can you tell me what you mean by “kind”?

Originally posted by Nineveh

On a personal note, from what I have seen, I'll say what chuck says governs your "science" no matter what lengths evo may need to go to in it's story telling, chuck is always right.

You need to check your glasses, then. I’ve spent very little time in this forum discussing specific evidence, and most of my time discussing assumptions, logic, methods, and the role of evidence in general. You haven’t really seen my science. If you’re referring to science in general, well, Darwin’s central idea still does resonate today: “descent with modification accounts for patterns of biological diversity.” As far as I can tell, and your post supports this, the creationist alternative would be “Life is diverse.” (Description, no explanation, right?)

 

[john2001]

Originally posted by Nineveh



Creationists are free to look at the evidence (like you can't have a proteins without instructions, and you can't have instructions without proteins) without chuck and the mainstream looking over their shoulders. The evidence doesn't need to be explained it needs to be described without the fairy tale work evo needs to add on.

I believe that you have fallen prey to one of the big lies of the creationist movement: that there is some sort of scientific opposition movement called "creation science". The so-called scientific creationist movement is purely a political propaganda and religious apologetics generating machine that generates a lot of paper, all of which is aimed at nonscientists, and none of which is of any scientific value.

 

[Stratnerd]

Originally posted by john2001

I believe that you have fallen prey to one of the big lies of the creationist movement: that there is some sort of scientific opposition movement called "creation science". The so-called scientific creationist movement is purely a political propaganda and religious apologetics generating machine that generates a lot of paper, all of which is aimed at nonscientists, and none of which is of any scientific value.

also, explaining is the job of science... describing can be done by anyone and is incredibly non-interesting, non-enlightening and nearly useless by itself.

For example, here's a description of DNA

TACTGATGCTAGCTAGTGAGTAGTCGTAGATGCTATGATGCATA

Evolution is valuable because it can actually explain why certain things are what they are. As far as I can see creationists can say "God did it" but they never can say how or even "what" to some degree.

 

[Nineveh]

Originally posted by john2001
Basically, the general pattern of observations of biology, all the way from traditional taxonomy down to the genetic level point to a general pattern of "relatedness" of all of biology. Hence, the notion of evolution, is indeed a phenomenon that is observed.

What you see evolving, I see as common Creator. Unless you want to take evo outside of adaptation, which is where it is running into trouble.

As to the laws of biology, these would be:
1) taxonomy
2) faunal succession (including the notion that lines may become extinct)
3) variation of allele frequencies with time.

I'll add those to the other answers given

Common descent via descent with modification explains neatly the vast collection of biological observation. This is the phenomenon of evolution.

It isn't observed that one kind of life changes into another.

These laws neatly sum up the majority of biological observation. Indeed, any alternate view of biology must necessarily be something that will account for the "evolution" appearance of all of biology.

Taxonomy is a law? It's a sorting method. Carl Linnaeus was a Christian by the way.

As to your comments regarding abiogenesis, it is irrelevent to the theory of origin of species if we ever understand the ultimate origin of life. Abiogenesis is a completely separate topic from evolution.

I know, I know... neither is the "big bang".
It's funny though that evo happens until we get back to that first cell, isn't it? Chuck can't account for the beginning, and without the beginning where would we be today?

Yes. FYI *all* scientific laws are our[ criteria. They are reductions of what are observed. The power of such critera is that they organize large collections of observations in a form that leads to theoretical understanding. In the case of the modern application of taxonomy via comparative genetics, we see a refinement of taxonomy, not its replacement or abandonment.

I beg to differ. We don't "group" gravity. Anyway, it will be neat to see Taxonomy applied to DNA

It's not my point of view alone, it is the point of view shared by mainstream biologists (which is to say the people who are actual practicing scientists in the field, as opposed to so-called creationist scientists, who do nothing but rant.)

Well, I'm talking to you I know, some feel that a "majority" held opinion means something, I'm of the mindset the majority can be wrong, too. I have a different opinion about Scientists like Behe and Kenyon.

Indeed, the brilliance of Darwin was to propose a system that lead to so much of modern biology. However, "Darwinian" evolution today really is not the same theory as that proposed by Darwin, because he did not know about genetics.

Maybe he should have hung out for a year, Medel ( a Christian )was coming

On the contrary. Everybody is now splitting hairs about what percentage of relatedness humans are to chimpanzees. The fact of that relatedness is not under dispute by mainstream scientists.

Once again, the "mainstream" is what is pointing out all the differences, it's boiling down to the DNA which Chuck can't account for.

What is quite clear is that you, as well as Agent Smith, and every other creationist on this forum, have preciious little knowledge of mainstream science, or you would recognize the attempts of myself, aharvey, and others to educate you on what are common concepts in the scientific community.

That's rich! LOL you mean, for instance, I should pitch the "mainstream" evo understanding of "junk DNA" for Dimo's lonely idea? Thanks, but even when presented with "facts" I'll still check them out before jumping on the band wagon simply because one of the evos in this forum says a thing is what they claim it to be.

Indeed, the rejection of evolution tends to be proportional to an individuals ignorance of the subject.

Actually the more I learn about evo, the less I see one kind changing into another. And we arrive back at the beginning, don't we? How many more millions of dollars do we need to "educate" the masses, how many more years before the majority can "grasp" the ever changing concepts....

 

[Nineveh]

Originally posted by aharvey

I made a prediction, not an assessment (creationists do commonly confuse the two!); the assessment of the prediction has not yet been done. It would be feasible to collect some relevant data, though, if you’re game!

Isn't that what we are working on now? The complexity of cell structure and how it all works together? Nature is taking a stab at it right now, and it's not looking good for the gradual process method.

Well, that's a basic difference between you and most scientists. We look at description as a starting point, not an end point. Scientific theories exist to provide explanations, not descriptions. True for cell theory, theory of gravity, etc., as much as it is for evolutionary theory.

When an evo digs a bone out of the ground, evo is assumed and all the real info get left to the details, like, where was it found, what other things were with it, etc. I think you purposely misunderstood what I was saying. In essence, to be absolutely clear: Give me the facts, save your story.

Subtle but critical difference between b and c, don’t you think? Who decides whether the grounds for religious dogma are “adequate”? Who decides whether the grounds for scientific dogma are “adequate”?

It takes more faith to believe non living matter makes itself into living matter. Biology rejected Haeckel's spontaneous regeneration, it took the faith of evo to ressurect Abiogenesis from the ashes.

It’s a curious thing. Creationists are about the only people I have ever heard use the term “abiogenesis,” and are about the only people who ‘think’ about it; very few evolutionary biologists worry much about “abiogenesis.” Why? Because at some point, it is trivially true, and completely independent of evolutionary theory. Unless life has always been present throughout all of time, then life had to have been derived from non-living precursors. There are only two differences between our perspectives; the first is that you think it is more reasonable that the complexities of the genetic code were resolved completely, instantly, and independently for each kind of living organism, whereas I think it is more reasonable that it took a long time to reach the current complexity of the genetic code, and that this process is still continuing, and that living organisms share the history of this process. The second difference is that you think that if evolutionary theory can’t “prove how” life evolved from non-life, then evolutionary theory can’t explain anything, and I think that evolutionary theory doesn’t need to prove anything (no theory can, as I’ve explained many, many times here), doesn’t even have to explain everything to be useful, and specifically doesn’t need to conclusively demonstrate what happened at the very beginning to be able to account for what’s happened since.

In reality even chuck knew it all had to start somewhere. Ignoring the problem won't make it go away, sorry.

Believe me, I would never rely on you to define my science. I just thought that when you referred to a “base assumption used to prove itself,” you were referring to something in particular. The base assumption I use did not fit your description, so I asked for clarification. Perhaps even you don’t know to what you were referring?

That's ok, too, I won't wait for you to correct your bretheren when they try passing off their own ideas as evo science either

I thought it was evident, when you start from the foundation of evo to prove evo. Evo isn't looking for anything that won't support it's theories of the day. For an example, which is tired and old now, bt since you are re asking:

There is no missing link between ape and man, so what's the new theory? Dinos to birds. Any links? Nope. So in a few years when that one gets worn out (prolly at the end of the exibit tour) what will be next? Let's wait and see

Read that sentence out loud. It makes no sense. Whatsoever. At the least, can you tell me what you mean by “kind”?

Really now. What made you grasp onto evo? The missing links that proved one thing turns into another?

 

[Stratnerd]

It isn't observed that one kind of life changes into another.

depends... there have been instances where bacteria have invaded protists and didn't kill the protist and even reproduced inside of it. When the bacteria were removed from the protist they died. So one could view the protist/bacteria as a single unit - analogous to mitochondria within your own cells, which have their own DNA, ribosomes, etc.

But by "kinds" I'm assuming that this is at the level of family(???). If so then we can probably estimate the time that two separate families shared a common ancestor and my guess it that, for most species, these estimates are probably in the range of 10's of millions of years - and you have the standard that you would like to see this in the lab? Not going to happen but neither is creation via poofing so your left with your own wits and evidence. If life was poofed then I'd, at least, expect reliable estimates that organisms have only been around a short time but that isn't the case. Look at the estimates for our own species.

Taxonomy is a law? It's a sorting method. Carl Linnaeus was a Christian by the way.

also worked well before Darwin. Again, all he did was sort and the creationist perspective gives no meaning to it and evolution explains the heirarchy like nothing else.

without the beginning where would we be today?

it doesn't account for it but then it doesn't preclude a natural beginning either, does it?

Anyway, it will be neat to see Taxonomy applied to DNA

it's called molecular systematics

I'm of the mindset the majority can be wrong, too.

obviously, at one time most scientists were probably creationists!

 

[Nineveh]

Originally posted by john2001

I believe that you have fallen prey to one of the big lies of the creationist movement: that there is some sort of scientific opposition movement called "creation science". The so-called scientific creationist movement is purely a political propaganda and religious apologetics generating machine that generates a lot of paper, all of which is aimed at nonscientists, and none of which is of any scientific value.

No actually, I don't like the terms "Creationism" or "Creation Science". People who start from a base of God have made strides in almost every area of Science. Mendel, Linnaeus, Newton and the like. In my world view Science is the tool used to understand how things work.

 

[Nineveh]

Originally posted by Stratnerd

also, explaining is the job of science... describing can be done by anyone and is incredibly non-interesting, non-enlightening and nearly useless by itself.

For example, here's a description of DNA

TACTGATGCTAGCTAGTGAGTAGTCGTAGATGCTATGATGCATA

Evolution is valuable because it can actually explain why certain things are what they are. As far as I can see creationists can say "God did it" but they never can say how or even "what" to some degree.

And the evo theory about how DNA became to be so smart is....?

 

[servent101]

Strathernd

it's called molecular systematics

-according to who? - if we go back to Science it is up to metaphysics to devise what constitutes a supersensible explanation - The whole of science has been shanghaied by the evolutionists.

With Christ's Love

Servent101

 

[Stratnerd]

Dinos to birds. Any links? Nope.

So you don't think Archaeopteryx had qualities that were both bird and dinosaurian?

Sinosauropteryx? Caudipteryx? Protarchaeopteryx? Unenlagia?